six3b

Ensembl ID:
ENSDARG00000054879
ZFIN ID:
ZDB-GENE-990415-128
Description:
sine oculis homeobox homolog 3b [Source:RefSeq peptide;Acc:NP_571438]
Human Orthologue:
SIX3
Human Description:
SIX homeobox 3 [Source:HGNC Symbol;Acc:10889]
Mouse Orthologue:
Six3
Mouse Description:
sine oculis-related homeobox 3 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102764]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24913 Nonsense Mutation detected in F1 DNA During 2018
sa35303 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077157 Nonsense 32 293 1 2
Genomic Location (Zv9):
Chromosome 12 (position 27128630)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25509618
GRCz11 12 25600978
KASP Assay ID:
554-7607.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCCCAATTTCGCGGATCGCCCTCTGCTTCTGGCGGGCAGCATTCCC[A/T]GAGCGAGGTCCCCGGAGGACTTACCGATGTTTCAGCTGCCCACCCTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077157 Nonsense 255 293 2 2
Genomic Location (Zv9):
Chromosome 12 (position 27130198)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25511186
GRCz11 12 25602546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGCAGTCTGCGCTCCATGTCAGAATCGGGCTGCACACCGCACAGCT[C/A]GGCAGAATCCCCGTGCGCGGCCGCCAGTCCCACGACCAGCGTCTCCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link