Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hsd17b14
- Ensembl ID:
- ENSDARG00000054842
- ZFIN ID:
- ZDB-GENE-040801-24
- Description:
- 17-beta-hydroxysteroid dehydrogenase 14 [Source:RefSeq peptide;Acc:NP_001003521]
- Human Orthologue:
- HSD17B14
- Human Description:
- hydroxysteroid (17-beta) dehydrogenase 14 [Source:HGNC Symbol;Acc:23238]
- Mouse Orthologue:
- Hsd17b14
- Mouse Description:
- hydroxysteroid (17-beta) dehydrogenase 14 Gene [Source:MGI Symbol;Acc:MGI:1913315]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa26078 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26078
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077111 | Nonsense | 173 | 271 | 7 | 9 |
The following transcripts of ENSDARG00000054842 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 30121987)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 29840026 GRCz11 3 29970868 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATATTAATACTCTCATAAATCCACAAGGGGGCGATCACCGCCATGACT[A/T]AAGCAATGGCTGTAGATGAGAGCCGCTATCAAGTGAGGGTGAACTGGTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
