ugt5f1

Ensembl ID:
ENSDARG00000054835
ZFIN IDs:
ZDB-GENE-100406-6, ZDB-GENE-100406-6
Description:
UDP glucuronosyltransferase 5 family, polypeptide F1 [Source:RefSeq peptide;Acc:NP_001170971]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36553 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077106 Nonsense 333 525 2 2
ENSDART00000129065 Nonsense 333 525 2 2
Genomic Location (Zv9):
Chromosome 18 (position 1050033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1598924
GRCz11 18 1250246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGATGAAATAGTCGCTGCTTTTGCTGAACTTCCCCAGAAAGTAATCT[G/A]GAGATACACTGGAGACAGGCCTGCCAATGTGGGCAACAATACACTACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link