zgc:162724

Ensembl ID:
ENSDARG00000054827
ZFIN ID:
ZDB-GENE-070424-72
Description:
hypothetical protein LOC100038788 [Source:RefSeq peptide;Acc:NP_001083037]
Human Orthologue:
C3orf32
Human Description:
chromosome 3 open reading frame 32 [Source:HGNC Symbol;Acc:24809]
Mouse Orthologue:
D630042P16Rik
Mouse Description:
RIKEN cDNA D630042P16 gene Gene [Source:MGI Symbol;Acc:MGI:2443733]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44990 Nonsense Mutation detected in F1 DNA During 2018
sa37553 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024756 Nonsense 59 417 3 14
ENSDART00000060014 Nonsense 23 381 2 13
ENSDART00000130604 Nonsense 55 413 2 13
Genomic Location (Zv9):
Chromosome 22 (position 33709470)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31071008
GRCz11 22 31020203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTGACCAGGATGGCGCGTCAGGTCCAGGCAGATCTTATGGAACTTG[T/A]ACAGGTAATCAATATTTATTTTTCCTAAAGTTGAACTCAAATATCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024756 Essential Splice Site 91 417 4 14
ENSDART00000060014 Essential Splice Site 55 381 3 13
ENSDART00000130604 Essential Splice Site 87 413 3 13
Genomic Location (Zv9):
Chromosome 22 (position 33709041)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31070579
GRCz11 22 31019774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGATATGATGCCTGTGGTTCCTGGATATGAGAATTTGGGACCTAATGG[T/C]GAGAAAAATTTCAGTAGTTTAAGCTGAATCTATGCATGATGTATTGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link