zgc:153441

Ensembl ID:
ENSDARG00000054797
ZFIN ID:
ZDB-GENE-060825-39
Description:
retinol dehydrogenase 13 [Source:RefSeq peptide;Acc:NP_001038920]
Human Orthologues:
RDH11, RDH12
Human Descriptions:
retinol dehydrogenase 11 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:17964]
retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19977]
Mouse Orthologues:
Rdh11, Rdh12
Mouse Descriptions:
retinol dehydrogenase 11 Gene [Source:MGI Symbol;Acc:MGI:102581]
retinol dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1925224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39258 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077042 Essential Splice Site 234 336 6 7
Genomic Location (Zv9):
Chromosome 19 (position 43940730)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42850532
GRCz11 19 42419969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAACTAATTACTGCATCAGACTTGTTTAATTGCTCTGTGCTTTAACTC[A/G]GGCTCTGGTGTGTCAGTGTTCTCTCTTCACCCTGGAGTGATCCGTACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link