zgc:171980

Ensembl ID:
ENSDARG00000054793
ZFIN ID:
ZDB-GENE-030131-9045
Description:
UPF0510 protein INM02 [Source:UniProtKB/Swiss-Prot;Acc:A7E2M3]
Human Orthologue:
C19orf63
Human Description:
chromosome 19 open reading frame 63 [Source:HGNC Symbol;Acc:27609]
Mouse Orthologue:
2310044H10Rik
Mouse Description:
RIKEN cDNA 2310044H10 gene Gene [Source:MGI Symbol;Acc:MGI:1916933]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2098 Nonsense Available for shipment Available now
sa9304 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077029 Nonsense 77 257 3 7
ENSDART00000133516 Nonsense 77 251 3 8

The following transcripts of ENSDARG00000054793 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 30398883)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30116922
GRCz11 3 30247764
KASP Assay ID:
554-2722.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACTTCGTGGTGCTCTACAGTTCAGGGGTGGRAGGGAAAACAGTGTGTA[T/G]CTCTCACAAAACCAGCTCTCAGAGAAAGACAGGAATACACTGAAGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077029 Nonsense 101 257 4 7
ENSDART00000133516 Nonsense 101 251 4 8

The following transcripts of ENSDARG00000054793 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 30398382)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30116421
GRCz11 3 30247263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCTCTACCTGTGTTTTTCAGGACGTGGCAGCAGTTGACGGTTTGTA[C/A]AGGATCCGGGTCCCAAGGGTCTCTCTACAGGTGGATCGGCAGACAGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link