
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ghra
- Ensembl ID:
- ENSDARG00000054771
- ZFIN ID:
- ZDB-GENE-070509-1
- Description:
- growth hormone receptor [Source:RefSeq peptide;Acc:NP_001077047]
- Human Orthologue:
- GHR
- Human Description:
- growth hormone receptor [Source:HGNC Symbol;Acc:4263]
- Mouse Orthologue:
- Ghr
- Mouse Description:
- growth hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95708]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34438 | Essential Splice Site | Available for shipment | Available now |
sa34437 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34438
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018886 | Essential Splice Site | 275 | 570 | 8 | 9 |
ENSDART00000127194 | Essential Splice Site | 275 | 570 | 7 | 8 |
ENSDART00000130074 | Essential Splice Site | 55 | 255 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 8 (position 32317042)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 31459768 GRCz11 8 31469000 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAATTCGGAAGTATGCACTTACATTTATTTTTATATTATTTTTTTCCAC[A/T]GGTTGATGGTAATCTTTTTACCACCTATTCCTGCACCTAAAATTAAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34437
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018886 | Nonsense | 488 | 570 | 9 | 9 |
ENSDART00000127194 | Nonsense | 488 | 570 | 8 | 8 |
ENSDART00000130074 | Nonsense | 201 | 255 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 8 (position 32313827)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 31456553 GRCz11 8 31465785 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTCCAGCTGGTTTGCGATGGAGCCTACACTTCAGAGACCACAGCCAGG[C/T]AGTTTTCTGCAGATGTCCCATCTAGTCCTGGTCCGGAACAGGAATACCAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
- Systemic lupus erythematosus: Association of systemic lupus erythematosus with C8orf13-BLK and ITGAM-ITGAX. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: