SMOC2 (2 of 2)

Ensembl ID:
ENSDARG00000054766
Description:
SPARC related modular calcium binding 2 [Source:HGNC Symbol;Acc:20323]
Human Orthologue:
SMOC2
Human Description:
SPARC related modular calcium binding 2 [Source:HGNC Symbol;Acc:20323]
Mouse Orthologue:
Smoc2
Mouse Description:
SPARC related modular calcium binding 2 Gene [Source:MGI Symbol;Acc:MGI:1929881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24829 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077021 Essential Splice Site 55 141 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA529 (position 4564)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43130429
GRCz11 13 43263999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAGTGCCGTGACCCTCAGCTGGCGGTCAGTCGAGGGCAATGCAAAGG[T/G]CAGAGTTCAGCAGCCATGAACAGGCCTGATGCCCTGTGAGGGTCCGGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Genome-wide association study of generalized vitiligo in an isolated European founder population identifies SMOC2, in close proximity to IDDM8. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link