zgc:162271

Ensembl ID:
ENSDARG00000054748
ZFIN ID:
ZDB-GENE-070424-29
Description:
CUE domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001082842]
Human Orthologue:
CUEDC1
Human Description:
CUE domain containing 1 [Source:HGNC Symbol;Acc:31350]
Mouse Orthologue:
Cuedc1
Mouse Description:
CUE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2144281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8782 Nonsense Mutation detected in F1 DNA During 2018
sa22674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100108 Nonsense 55 383 1 10
ENSDART00000145255 Nonsense 55 383 2 11

The following transcripts of ENSDARG00000054748 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30510322)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31332029
GRCz11 15 31212770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACCAGGCTATGGAGGACTTCAAAACCATGTTTCCTACCATGGACTA[T/A]GAGGTGATCGAGTGTGTACTGCGCTCCAATAATGGTGCTGTGGACGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100108 Nonsense 179 383 3 10
ENSDART00000145255 Nonsense 179 383 4 11

The following transcripts of ENSDARG00000054748 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30503250)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31324957
GRCz11 15 31205698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATTACTTGGCAATCTGCCTGATGACTTCCTGCGAATCCTGCCTCAA[C/T]AGTTAGACAGTATACAGGTGAGCATTAATGGAAGTGAAACCCGTTTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link