or116-1

Ensembl ID:
ENSDARG00000054734
ZFIN ID:
ZDB-GENE-070806-77
Description:
odorant receptor, family F, subfamily 116, member 1 [Source:RefSeq peptide;Acc:NP_001122049]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35919 Nonsense Available for shipment Available now
sa9208 Nonsense Mutation detected in F1 DNA During 2018
sa6384 Nonsense Mutation detected in F1 DNA During 2018
sa45544 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076985 Nonsense 131 314 1 2
ENSDART00000132518 Nonsense 131 311 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30594566)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31416273
GRCz11 15 31297014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTGCTGCGATGGCTTTTGATCGCTACATTGCCATTTGTATGCCACTG[C/T]GATATAATGCTCTCATGACACCAAGAGCTGTGATGACGGTTGTGGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076985 Nonsense 185 314 1 2
ENSDART00000132518 Nonsense 185 311 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30594728)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31416435
GRCz11 15 31297176
KASP Assay ID:
2260-8682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCAGATCCCATATTGTGAGTTTGTTTTGTGATAACCCTTCTTTACTT[A/T]AGCTGGCCTGTGGTGATACTACTMTCAACAATATATACGGCTWATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076985 Nonsense 199 314 1 2
ENSDART00000132518 Nonsense 199 311 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30594771)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31416478
GRCz11 15 31297219
KASP Assay ID:
554-4594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACTTAAGCTGGCCTGTGGTGATACTACTMTCAACAATATATACGGCT[T/A]ATTTTTAACAGCCATTATGCAGATTATTACCATTTCCATTCAAGCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076985 Nonsense 298 314 1 2
ENSDART00000132518 Nonsense 298 311 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30595067)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31416774
GRCz11 15 31297515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTCCTATTATGAATCCTATTGTTTACGGGTTGAATAGCCATGAAATA[C/T]GAAAACATATCCTGAAAACATTTCACAGAAAAACTTCAGTGTAAAATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link