si:dkey-58f10.1

Ensembl ID:
ENSDARG00000054606
ZFIN ID:
ZDB-GENE-060526-311
Description:
Novel protein similar to vertebrate mitochondrial ribosomal protein L1 (MRPL1) (Zgc:91951 ) [Source:
Human Orthologue:
MRPL1
Human Description:
mitochondrial ribosomal protein L1 [Source:HGNC Symbol;Acc:14275]
Mouse Orthologue:
Mrpl1
Mouse Description:
mitochondrial ribosomal protein L1 Gene [Source:MGI Symbol;Acc:MGI:2137202]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33661 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7573 Missense Mutation detected in F1 DNA During 2018
sa31466 Nonsense Available for shipment Available now
sa15306 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076835 Essential Splice Site 19 324 1 9
Genomic Location (Zv9):
Chromosome 5 (position 40425737)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38225127
GRCz11 5 38825280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACAAATTTATCAACATGGCTGCCCCCGCGAGGAGTGTTTTAAGAGG[T/C]CAGTTTTAATCATTGCAAAGAATTTTACTTATAATCTCTTAATGTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076835 Missense 73 324 3 9
Genomic Location (Zv9):
Chromosome 5 (position 40426506)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38225896
GRCz11 5 38826049
KASP Assay ID:
554-4065.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGAAGAAAGAGGAGGCTGTTAAGGAAAAAGTGGTGAAAGAGAGAMA[A/T]ATTATTGATGACAAAGACAGACATAAACCATTTGGACTCACAGCCTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076835 Nonsense 209 324 6 9
Genomic Location (Zv9):
Chromosome 5 (position 40431769)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38231159
GRCz11 5 38831312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAATTGCAGATTTTAGCTGATGAGATCACAGCAGATTTCTACTTGGCT[G/T]AGCCAGACATCCTACCAAAGCTGGTCCCTTTGAAGAACAAGCTGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076835 Essential Splice Site 265 324 7 9
Genomic Location (Zv9):
Chromosome 5 (position 40432068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38231458
GRCz11 5 38831611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KYATGAATATATRGTTGAGGACATCTATGTTAACACAGAAGTTGCAACGG[T/G]AAGTCAGATTGAGCTGTTCTGAYTGGTATAYATTTTYCTGTATAATAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link