znhit1

Ensembl ID:
ENSDARG00000054574
ZFIN ID:
ZDB-GENE-050417-272
Description:
zinc finger HIT domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001017401]
Human Orthologue:
ZNHIT1
Human Description:
zinc finger, HIT-type containing 1 [Source:HGNC Symbol;Acc:21688]
Mouse Orthologue:
Znhit1
Mouse Description:
zinc finger, HIT domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917353]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076800 Nonsense 101 154 4 5
Genomic Location (Zv9):
Chromosome 5 (position 40208433)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38007823
GRCz11 5 38607976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTTTTTTTTNAAATCCAGGACTTAAGTGTTAGTGAGGGTCCAAACTA[T/A]CTGACTGCCTGTGCGGAGCCTTCTAAGATTCCTCAGCGTCATTTCTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link