
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000054572
- Ensembl ID:
- ENSDARG00000054572
- Mouse Orthologue:
- 4930434E21Rik
- Mouse Description:
- RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35926 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24991 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35926
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076793 | Nonsense | 48 | 515 | 2 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 30842763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 31664470 GRCz11 15 31545211 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCCAACAGGGATTTTGAAAGGTCACTCCGCCCCTGTTGCCTACGTCTG[T/A]GTCACGTCAGAGAATGGACACATTTACTCAGTGTCCACAGACAACACTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24991
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076793 | Essential Splice Site | 67 | 515 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 30846913)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 31668620 GRCz11 15 31549361 - KASP Assay ID:
- 554-7337.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGCAACATAAATATGAAAACGTATGATTTTTTTATCATGCTTTTTTTTC[A/T]GATATGGCATATAAAGGACCAGACGTGTCTGTTTACTGCACATCCAAATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: