smg1

Ensembl ID:
ENSDARG00000054570
ZFIN ID:
ZDB-GENE-061013-767
Description:
serine/threonine-protein kinase SMG1 [Source:RefSeq peptide;Acc:NP_001073513]
Human Orthologues:
AC009060.1, AC009086.1, AC009086.2, SMG1
Human Descriptions:
Putative uncharacterized SMG1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6P435]
SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) [Source:HGNC Symbol;Acc:3004
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NN41]
Mouse Orthologue:
Smg1
Mouse Description:
SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) Gene [Source:MGI Symbol;Acc:

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15112 Nonsense Available for shipment Available now
sa14826 Nonsense Mutation detected in F1 DNA During 2018
sa17501 Essential Splice Site Available for shipment Available now
sa20041 Nonsense Available for shipment Available now
sa20040 Essential Splice Site Available for shipment Available now
sa1093 Nonsense F2 line generated During 2018
sa33204 Essential Splice Site Available for shipment Available now
sa44562 Nonsense Mutation detected in F1 DNA During 2018
sa20039 Nonsense Available for shipment Available now
sa12615 Nonsense Available for shipment Available now
sa26086 Nonsense Mutation detected in F1 DNA During 2018
sa40090 Nonsense Mutation detected in F1 DNA During 2018
sa33203 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 81 3635 3 62
ENSDART00000076796 Nonsense 81 3640 3 62
ENSDART00000076764 Nonsense 81 3635 3 62
ENSDART00000076796 Nonsense 81 3640 3 62
Genomic Location (Zv9):
Chromosome 3 (position 31305687)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31023726
GRCz11 3 31154568
KASP Assay ID:
1641-0502.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTTTTATTGAAGGGAACTGACAATATTCCTGCTTTGTAGGTGGATA[C/A]GACGCTGATGGAGGCCTCTCTGAAAATGCTTATGGTTGGAAGTCGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 81 3635 3 62
ENSDART00000076796 Nonsense 81 3640 3 62
ENSDART00000076764 Nonsense 81 3635 3 62
ENSDART00000076796 Nonsense 81 3640 3 62
Genomic Location (Zv9):
Chromosome 3 (position 31305687)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31023726
GRCz11 3 31154568
KASP Assay ID:
1641-0502.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTTTTATTGAAGGGAACTGACAATATTCCTGCTTTGTAGGTGGATA[C/A]GACGCTGATGGAGGCCTCTCTGAAAATGCTTATGGTTGGAAGTCGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Essential Splice Site 130 3635 3 62
ENSDART00000076796 Essential Splice Site 130 3640 3 62
Genomic Location (Zv9):
Chromosome 3 (position 31305540)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31023579
GRCz11 3 31154421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATGGAAACCGTGCTTTAGCTACAAAGGACATGAGGAAATCACAGGG[T/A]ATGTTCACCTCACAGGACCTCATGCATTGCTTGCTGTGAAAGAATTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 181 3635 5 62
ENSDART00000076796 Nonsense 181 3640 5 62
Genomic Location (Zv9):
Chromosome 3 (position 31305186)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31023225
GRCz11 3 31154067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTTTAATGAGTGTTTTTTGCTTTACAGGTCCTAGTGAAACAGT[T/A]GGATTCCATTTTGAGCACCCTGAATGACATTTTGAATGAGAGGTAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Essential Splice Site 665 3635 14 62
ENSDART00000076796 Essential Splice Site 665 3640 14 62
Genomic Location (Zv9):
Chromosome 3 (position 31300780)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31018819
GRCz11 3 31149661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCTGTCCAGTATGCAGTGCTCTACACTCTCTACTCTCACTGCACCAG[G/T]TAACAAACCAATGGTTTCATCTAAATAATGCATTCTGAAAAATCTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1093
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 760 3635 17 62
ENSDART00000076796 Nonsense 760 3640 17 62
Genomic Location (Zv9):
Chromosome 3 (position 31297837)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31015876
GRCz11 3 31146718
KASP Assay ID:
554-0995.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCAAGGGAATGAACTAAAATATGTGTTGTCTTTCCTCTGTTCAGCCT[T/A]GAATGAGGACACCACCATATGTCTGCAGGCATGTAACAGTCTACAGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Essential Splice Site 822 3635 18 62
ENSDART00000076796 Essential Splice Site 822 3640 18 62
Genomic Location (Zv9):
Chromosome 3 (position 31297505)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31015544
GRCz11 3 31146386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCCTTTGGGAAATTGCTGAGATCTGTTCCCATGCACGTCGCACTGAG[G/A]TTTGCCAGACTCCTCTTCATCTGTCTTAAATCTGCACAATAGAAATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 1577 3635 32 62
ENSDART00000076796 Nonsense 1582 3640 32 62
Genomic Location (Zv9):
Chromosome 3 (position 31291072)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31009111
GRCz11 3 31139953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCCTACAGTTAGCGTTGGTGTCGGGGAGCCAGACTTTGTCCTTGGG[C/T]AACTTTACCAGCTCTCAACTACTCAGGCTCCTGAAGTGGCCAAATCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 1681 3635 34 62
ENSDART00000076796 Nonsense 1686 3640 34 62
Genomic Location (Zv9):
Chromosome 3 (position 31289735)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31007774
GRCz11 3 31138616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAATGAAGAAGATGATGAGGACGACATGGTAGATGTAATTGGCCGA[C/T]AGCTGTTGGGTGCCTGTCCCTGGCTTTCAGATGTAGAGGACACTGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 1686 3635 34 62
ENSDART00000076796 Nonsense 1691 3640 34 62
Genomic Location (Zv9):
Chromosome 3 (position 31289718)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31007757
GRCz11 3 31138599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGACGACATGGTAGATGTAATTGGCCGACAGCTGTTGGGTGCCTG[T/A]CCCTGGCTTTCAGRTGTAGAGGACACTGTGACCGATGGACTCATTGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 1737 3635 35 62
ENSDART00000076796 Nonsense 1742 3640 35 62
Genomic Location (Zv9):
Chromosome 3 (position 31289482)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31007521
GRCz11 3 31138363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATCGATCATGAATTTATTGATGCTTCAATTATTAGGTGCCTATAGAT[G/T]AAGATGATCCCAAGCTGCTCCTGAACAACCAGAACAGCAAGCAGAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Nonsense 2283 3635 42 62
ENSDART00000076796 Nonsense 2288 3640 42 62
Genomic Location (Zv9):
Chromosome 3 (position 31282393)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31000432
GRCz11 3 31131274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTCTTGGCAAAGGAGCTCTGGTGTTCCTGCACCACTCCTAGTGAGTG[G/A]TGGAGCGTCACTCAGGTAAGAGGAACCACTGCTCATGTTCTAGTCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076764 Essential Splice Site 2444 3635 45 62
ENSDART00000076796 Essential Splice Site 2449 3640 45 62
Genomic Location (Zv9):
Chromosome 3 (position 31281652)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30999691
GRCz11 3 31130533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGACATCACACGTAGCCTTTTCTCCTCCCGTGTGGCTGAAATTAAGG[T/A]GAGAATTTTGTCTGAATAATAGCAAAATATATCAGTTGCAGTTATTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link