
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hesx1
- Ensembl ID:
- ENSDARG00000054509
- ZFIN ID:
- ZDB-GENE-990415-130
- Description:
- hesx homeobox 1 [Source:RefSeq peptide;Acc:NP_571424]
- Human Orthologue:
- HESX1
- Human Description:
- HESX homeobox 1 [Source:HGNC Symbol;Acc:4877]
- Mouse Orthologue:
- Hesx1
- Mouse Description:
- homeobox gene expressed in ES cells Gene [Source:MGI Symbol;Acc:MGI:96071]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35157 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14173 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35157
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076711 | Nonsense | 34 | 72 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 43713993)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 42344129 GRCz11 11 42633475 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTATTGATATACGTGAAGAACTTGCGAAGAAGCTTCATTTAGATGAGGAC[A/T]GAATCCAGGTGAACACTGATTTAAAATCTCAAATATTGCATCATTTACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14173
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076711 | Nonsense | 69 | 72 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 43715021)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 42345157 GRCz11 11 42634503 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTCCCAGTTCCTCATGGTGAAAAACGTCCTCAGCGATTTACAAACCGGC[A/T]GAGAAGAACACTGAGAGTAGAACTACATTTCTNNNNNNNNNNNNNNNTTM
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: