stambpa

Ensembl ID:
ENSDARG00000054501
ZFIN ID:
ZDB-GENE-040426-1551
Description:
STAM-binding protein-like A [Source:UniProtKB/Swiss-Prot;Acc:Q6TH47]
Human Orthologue:
STAMBP
Human Description:
STAM binding protein [Source:HGNC Symbol;Acc:16950]
Mouse Orthologue:
Stambp
Mouse Description:
STAM binding protein Gene [Source:MGI Symbol;Acc:MGI:1917777]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31802 Nonsense Available for shipment Available now
sa401 Essential Splice Site Available for shipment Available now
sa1612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043502 Nonsense 63 173 2 10
ENSDART00000073631 Nonsense 63 79 2 10
ENSDART00000076693 Nonsense 63 418 2 11
Genomic Location (Zv9):
Chromosome 10 (position 43493876)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42300371
GRCz11 10 42128751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAACATCTACGCCGACGAGGGAAACGTGGAGCACGCCTTCATCCTGTA[C/A]AACAAATACATCACGTAAGAGATCAATAATCACTGACGCTGCTGCATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043502   79 173 3 10
ENSDART00000073631 Essential Splice Site 79 79 3 10
ENSDART00000076693   79 418 3 11
Genomic Location (Zv9):
Chromosome 10 (position 43490827)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42297322
GRCz11 10 42125702
KASP Assay ID:
554-0364.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTCCTTTTATTTAGGTTGTTTATTGAAAAACTTCCCAAACATCGGGA[G/A]TACAAAACCGCCAACATTCCTGAGAAGAAAGAAACGATGAGGGTAAGATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043502   None 173 8 10
ENSDART00000073631   None 79 8 10
ENSDART00000076693 Nonsense 334 418 9 11
Genomic Location (Zv9):
Chromosome 10 (position 43480390)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42286885
GRCz11 10 42115265
KASP Assay ID:
554-1553.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTTGATAATAATCAAWCTCTCTTGTATTCCTCAAGACGCACCCGACG[C/T]AGACGGCCTTTCTGTCCAGTGTGGATCTGCACACACACTGCTCCTATCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link