zgc:153887

Ensembl ID:
ENSDARG00000054458
ZFIN IDs:
ZDB-GENE-061013-184, ZDB-GENE-061013-184
Description:
sarcolemmal membrane-associated protein [Source:RefSeq peptide;Acc:NP_001070722]
Human Orthologue:
SLMAP
Human Description:
sarcolemma associated protein [Source:HGNC Symbol;Acc:16643]
Mouse Orthologue:
Slmap
Mouse Description:
sarcolemma associated protein Gene [Source:MGI Symbol;Acc:MGI:1933549]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30953 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21976 Nonsense Available for shipment Available now
sa41914 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076650 Essential Splice Site 9 437 1 13
ENSDART00000104444   None 823 None 23
Genomic Location (Zv9):
Chromosome 11 (position 43448500)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42073710
GRCz11 11 42343648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGTGGAGGAGACTGCACTTTAATCCAACAGTACATTGAGTGTCAAT[G/A]TGAGTACACAGCATTCTTTCAAACGCCTTCCACAGCTGTACTAATGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076650 Nonsense 54 437 3 13
ENSDART00000104444 Nonsense 440 823 13 23
Genomic Location (Zv9):
Chromosome 11 (position 43443688)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42068898
GRCz11 11 42338836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATAACCAGACGACAGTGGACAACAGCTTACCCAGTCCAGACAGACTT[A/T]AAGGTATTGTCACATTTCAGGCATTTTCATTTCAATTTGAATTTCTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076650 Nonsense 238 437 8 13
ENSDART00000104444 Nonsense 624 823 18 23
Genomic Location (Zv9):
Chromosome 11 (position 43430461)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42055671
GRCz11 11 42325609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCAGGGAGACCTGAGCATCGTCACTGCCGAGCTGGACAAATGGAGA[C/T]AGACGGCAGCCAAATATGAAGTGGAGATCAGCAATCTGCAGGCCAGCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link