
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
yipf6
- Ensembl ID:
- ENSDARG00000054433
- ZFIN ID:
- ZDB-GENE-040625-76
- Description:
- Protein YIPF6 [Source:UniProtKB/Swiss-Prot;Acc:Q6IQ85]
- Human Orthologue:
- YIPF6
- Human Description:
- Yip1 domain family, member 6 [Source:HGNC Symbol;Acc:28304]
- Mouse Orthologue:
- Yipf6
- Mouse Description:
- Yip1 domain family, member 6 Gene [Source:MGI Symbol;Acc:MGI:1925179]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17721 | Nonsense | Available for shipment | Available now |
sa40492 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa17721
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076627 | Nonsense | 101 | 240 | 4 | 7 |
ENSDART00000148213 | Nonsense | 90 | 229 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37367593)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35149542 GRCz11 5 35749695 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTKTGYTTGGCTGTTTTTAGGGGATTTATGGGGACCTCTCCTGCTCTG[T/A]GTCACTCTGGCTTTGTAAGTYGTWATGTTGACATGCCACTTTCAGGCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40492
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076627 | Nonsense | 122 | 240 | 5 | 7 |
ENSDART00000148213 | Nonsense | 111 | 229 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37367740)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35149689 GRCz11 5 35749842 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGAATGCTGCAGGGTGGGTCTGCTGACAGTGAAGAGGATGGCAGGCCA[C/T]AGTTTGCAGAAGTCTTTGTCATCATCTGGTTCGGTTCTGTAATCATCACC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: