slc7a6

Ensembl ID:
ENSDARG00000054423
ZFIN ID:
ZDB-GENE-000607-21
Description:
Y+L amino acid transporter 2 [Source:UniProtKB/Swiss-Prot;Acc:Q59I64]
Human Orthologue:
SLC7A6
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a6
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31575 Essential Splice Site Available for shipment Available now
sa9302 Essential Splice Site Mutation detected in F1 DNA During 2018
sa965 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076615 Essential Splice Site 137 468 1 9
Genomic Location (Zv9):
Chromosome 7 (position 29977396)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28369919
GRCz11 7 28641112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAGCCGCCGTATTCTGCGTCTCGGCTCATTGCTGCAGCTTGTATCTG[T/C]AAGTAAAATTCACAGGACATACCGTTGCTCTCCATGCTTGTTTTTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076615 Essential Splice Site 268 468 4 9
Genomic Location (Zv9):
Chromosome 7 (position 29972570)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28365093
GRCz11 7 28636286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGTGCTCGACATGAGTGCCATCCTTGCYAGTGATGCTGTCGCTGTG[G/A]TGAGTTCATGTTACCGGCTTTGTTCTATTCAGWAGRGYTTATCTCTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076615 Essential Splice Site 447 468 9 9
Genomic Location (Zv9):
Chromosome 7 (position 29962395)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28354918
GRCz11 7 28626111
KASP Assay ID:
554-0870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTAAAAATGTTAGTGGTCATTTTTTTTTTAAACATGTCTCTGTCCCGC[A/T]GGTGCCATCACCCGTTTCACCCAGTTCACCTGCTTTTGTGTGCTCACCGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link