zgc:136895

Ensembl ID:
ENSDARG00000054418
ZFIN ID:
ZDB-GENE-060421-4694
Description:
hypothetical protein LOC797699 [Source:RefSeq peptide;Acc:NP_001035467]
Human Orthologue:
C3orf32
Human Description:
chromosome 3 open reading frame 32 [Source:HGNC Symbol;Acc:24809]
Mouse Orthologue:
D630042P16Rik
Mouse Description:
RIKEN cDNA D630042P16 gene Gene [Source:MGI Symbol;Acc:MGI:2443733]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37552 Nonsense Mutation detected in F1 DNA During 2018
sa43876 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104728 Nonsense 63 382 4 13
Genomic Location (Zv9):
Chromosome 22 (position 33661436)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31022974
GRCz11 22 30972169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACAGTGAGTCTTTTATTTCACCCTCAGTTATTCCACCATCTGATTTT[G/T]GATCGCGACAACCAGAAGCCCCACCCAGAGCTCCCGAGAGACGCTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104728 Essential Splice Site 182 382 7 13
Genomic Location (Zv9):
Chromosome 22 (position 33656987)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31018525
GRCz11 22 30967720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGACTGTAAAAAATCAATCCGTGTTCCTCACACATCGACTGTCAAAG[T/C]AAAAAAATACAAATAAAAAACTTTGTTATTCATCACAATCATTAACTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link