
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-126g16.10
- Ensembl ID:
- ENSDARG00000054373
- ZFIN ID:
- ZDB-GENE-081104-528
- Description:
- hypothetical protein LOC100002020 [Source:RefSeq peptide;Acc:NP_001122024]
- Human Orthologues:
- B3GNT3, B3GNT6
- Human Descriptions:
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 [Source:HGNC Symbol;Acc:13528]
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) [Source:HGNC Symbol;
- Mouse Orthologues:
- B3gnt3, B3gnt6
- Mouse Descriptions:
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:215253
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) Gene [Source:MGI Sym
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa27149 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa27149
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076561 | Nonsense | 204 | 387 | 2 | 2 |
ENSDART00000080872 | Nonsense | 204 | 387 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 14090036)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 13535380 GRCz11 8 13573085 - KASP Assay ID:
- 2260-0275.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTCTTCAACCTCACACTGAAGCAGATCCTTTTCTTAGAGTGGATGGAC[A/T]GAAGGTGCCCGAACGCCAGATTCCTTTTAAATGGAGACGATGACATTTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Tumor biomarkers: A genome wide association study of genetic loci that influence tumour biomarkers cancer antigen 19-9, carcinoembryonic antigen and α fetoprotein and their associations with cancer risk. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: