sla1

Ensembl ID:
ENSDARG00000054340
ZFIN ID:
ZDB-GENE-050904-3
Description:
src-like-adapter [Source:RefSeq peptide;Acc:NP_001030161]
Human Orthologue:
SLA
Human Description:
Src-like-adaptor [Source:HGNC Symbol;Acc:10902]
Mouse Orthologue:
Sla
Mouse Description:
src-like adaptor Gene [Source:MGI Symbol;Acc:MGI:104295]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43315 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076518 Essential Splice Site 205 271 8 8
Genomic Location (Zv9):
Chromosome 19 (position 36462770)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35327290
GRCz11 19 34914410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCTTCCGCTTGTGAATGACCGCTGTATAAATATGTCTCTGTGTGAAC[A/T]GGTCACAATTATTAAACCCAAGTGAACTGGACAGCGTAGACAGCAGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
  • Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link