wisp1a

Ensembl ID:
ENSDARG00000054331
ZFIN ID:
ZDB-GENE-070705-178
Description:
WNT1 inducible signaling pathway protein 1a [Source:RefSeq peptide;Acc:NP_001159702]
Human Orthologue:
WISP1
Human Description:
WNT1 inducible signaling pathway protein 1 [Source:HGNC Symbol;Acc:12769]
Mouse Orthologue:
Wisp1
Mouse Description:
WNT1 inducible signaling pathway protein 1 Gene [Source:MGI Symbol;Acc:MGI:1197008]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43316 Nonsense Mutation detected in F1 DNA During 2018
sa39254 Nonsense Mutation detected in F1 DNA During 2018
sa36876 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076506 Nonsense 48 360 2 5
ENSDART00000147714 Nonsense 19 309 1 4
Genomic Location (Zv9):
Chromosome 19 (position 36500996)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35365516
GRCz11 19 34952636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAACCCATCACCCCGCAGCCCTATAATCGCAGCCAGTACTGCCAATG[G/A]CCCTGCAAATGCCCCAAAACTCCTCCCATGTGCCCGCCAGGTGTCAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076506 Nonsense 186 360 3 5
ENSDART00000147714   None 309 None 4
Genomic Location (Zv9):
Chromosome 19 (position 36502963)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35367483
GRCz11 19 34954603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTAAAGTCCACGGCCAATGCTGTGAGCTGTGGATCTGTGATGAATCC[A/T]GAAGGGGGCGCAAGACCGCACCGCGACACACGATGGCGGGTACGATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076506 Nonsense 232 360 4 5
ENSDART00000147714 Nonsense 181 309 3 4
Genomic Location (Zv9):
Chromosome 19 (position 36503252)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35367772
GRCz11 19 34954892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCTCTTGGAGTCCCTGCTCGAAGACCTGCGGTCGTGGCGTCTCTTTA[C/T]GAATCACCAACAACAACAAAAAGTGTGAGATGGTCAACGAGAGCAGACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link