stk33

Ensembl ID:
ENSDARG00000054318
ZFIN ID:
ZDB-GENE-040724-242
Description:
serine/threonine-protein kinase 33 [Source:RefSeq peptide;Acc:NP_001038554]
Human Orthologue:
STK33
Human Description:
serine/threonine kinase 33 [Source:HGNC Symbol;Acc:14568]
Mouse Orthologue:
Stk33
Mouse Description:
serine/threonine kinase 33 Gene [Source:MGI Symbol;Acc:MGI:2152419]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20953 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076496 Essential Splice Site 248 500 10 14
ENSDART00000100646 Essential Splice Site 248 500 9 13
ENSDART00000144896   None 73 None 3

The following transcripts of ENSDARG00000054318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 29715219)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28107742
GRCz11 7 28378935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACATTTAATAGTGAAATGTGCATAAAGTGTGTGTGTCCCTATTTTC[A/T]GGTTGTGTGGAGAGCCTCCTTTTGGATCTAGCTCTAAGGAGAGGCTTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link