zgc:77151

Ensembl ID:
ENSDARG00000054307
ZFIN ID:
ZDB-GENE-030131-9097
Description:
hypothetical protein LOC337153 [Source:RefSeq peptide;Acc:NP_991128]
Human Orthologues:
ARID5A, ARID5B
Human Descriptions:
AT rich interactive domain 5A (MRF1-like) [Source:HGNC Symbol;Acc:17361]
AT rich interactive domain 5B (MRF1-like) [Source:HGNC Symbol;Acc:17362]
Mouse Orthologues:
Arid5a, Arid5b
Mouse Descriptions:
AT rich interactive domain 5A (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2443039]
AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15960 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076483   None 305 11 11
ENSDART00000125994   None 303 None 7
ENSDART00000126335 Nonsense 693 856 10 10
ENSDART00000144178 Nonsense 686 849 9 9
Genomic Location (Zv9):
Chromosome 21 (position 36311467)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37300816
GRCz11 21 36986003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCACCAAGAGGCCTGCAGGGGACATGGAGCTCACAGACCTTCAGAGT[C/T]GAGAAGTCCAGTCTGRGACCAAGAGGCCGAAGATGGAAGCTGAGGATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link