zgc:153393

Ensembl ID:
ENSDARG00000054301
ZFIN ID:
ZDB-GENE-060825-174
Description:
Protein KTI12 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q0P457]
Human Orthologue:
KTI12
Human Description:
KTI12 homolog, chromatin associated (S. cerevisiae) [Source:HGNC Symbol;Acc:25160]
Mouse Orthologue:
Kti12
Mouse Description:
KTI12 homolog, chromatin associated (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923547]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18293 Essential Splice Site, Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076484 Splice Site None 275 None 9
ENSDART00000136776 Essential Splice Site 229 275 8 9
Genomic Location (Zv9):
Chromosome 18 (position 26720100)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26793355
GRCz11 18 26775733
KASP Assay ID:
2261-2268.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCGTCCCYGGAGATCTCATTTCCATTCCTGGAGCCACAGAAAAGATA[T/A]CCTTWATTTTTGCATCAGTCTGTGTGTGCATATRTGTATAKAAAAATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link