
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
caprin1b
- Ensembl ID:
- ENSDARG00000054272
- ZFIN ID:
- ZDB-GENE-040426-2020
- Description:
- cell cycle associated protein 1b [Source:RefSeq peptide;Acc:NP_998233]
- Human Orthologue:
- CAPRIN1
- Human Description:
- cell cycle associated protein 1 [Source:HGNC Symbol;Acc:6743]
- Mouse Orthologue:
- Caprin1
- Mouse Description:
- cell cycle associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1858234]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23351 | Nonsense | Available for shipment | Available now |
sa29071 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23351
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098889 | Nonsense | 301 | 695 | 9 | 18 |
ENSDART00000139519 | None | 87 | None | 3 | |
ENSDART00000143016 | None | 127 | None | 5 |
The following transcripts of ENSDARG00000054272 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 36696640)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 38278343 GRCz11 18 38259351 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTGTTCTCTCCAGTTTGTAAATAGGCAGTTTGTTTCGGAGAGCACGTA[T/G]AGTACTGGTGAAAAGGAGCAAAGAGAAGACTGGAGCGTGGAACCTGAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29071
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098889 | Essential Splice Site | 632 | 695 | 16 | 18 |
ENSDART00000139519 | None | 87 | None | 3 | |
ENSDART00000143016 | None | 127 | None | 5 |
The following transcripts of ENSDARG00000054272 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 36692899)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 38274602 GRCz11 18 38255610 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCACGCGGCATCATTAACGGCTACAGAGGACCATCCAATGGCTTCAGAGG[T/C]ACACAACAGCATGCGTTAGTAGGGAGTTCAGTTCACACTTATTCCCTGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: