zgc:136860

Ensembl ID:
ENSDARG00000054264
ZFIN ID:
ZDB-GENE-060312-33
Description:
conserved oligomeric Golgi complex subunit 4 [Source:RefSeq peptide;Acc:NP_001034912]
Human Orthologue:
COG4
Human Description:
component of oligomeric golgi complex 4 [Source:HGNC Symbol;Acc:18620]
Mouse Orthologue:
Cog4
Mouse Description:
component of oligomeric golgi complex 4 Gene [Source:MGI Symbol;Acc:MGI:2142808]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44664 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076425 Nonsense 615 781 15 19
ENSDART00000135498   None 601 None 14
Genomic Location (Zv9):
Chromosome 7 (position 30374757)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28767099
GRCz11 7 29038249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATGTACAGGAGGGTCTACAGGAGCTTAACAACACTGCTATCAGGCCA[C/T]AAGTAAAGCCCTGGATCAGCAGCTTCCTGTCTGTCTCGCACAATATTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link