si:dkey-47e6.1

Ensembl ID:
ENSDARG00000054253
ZFIN ID:
ZDB-GENE-090313-313
Description:
Sine oculis-binding protein homolog [Source:UniProtKB/Swiss-Prot;Acc:A5X7A0]
Human Orthologue:
SOBP
Human Description:
sine oculis binding protein homolog (Drosophila) [Source:HGNC Symbol;Acc:29256]
Mouse Orthologue:
Sobp
Mouse Description:
sine oculis-binding protein homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924427]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42239 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076423 Essential Splice Site 167 936 4 8
Genomic Location (Zv9):
Chromosome 13 (position 32985135)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32631083
GRCz11 13 32761533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAATCATAGTGCCCTTAATCCCGCCCCCTCTCATAAAAGCACCAGCAG[G/A]TAAGAATCACAGCCACGTTATCTGAGCATCAAACCTGCACACAGAAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link