zgc:91897

Ensembl ID:
ENSDARG00000054224
ZFIN ID:
ZDB-GENE-040711-1
Description:
importin-11 isoform 1 [Source:RefSeq peptide;Acc:NP_001153133]
Human Orthologue:
IPO11
Human Description:
importin 11 [Source:HGNC Symbol;Acc:20628]
Mouse Orthologue:
Ipo11
Mouse Description:
importin 11 Gene [Source:MGI Symbol;Acc:MGI:2442377]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2457 Nonsense F2 line generated During 2018
sa34440 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2457
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045295 Nonsense 108 975 4 29
ENSDART00000133245   None 85 None 3
ENSDART00000138268 Nonsense 108 543 5 17
ENSDART00000145325 Nonsense 108 961 4 29
Genomic Location (Zv9):
Chromosome 8 (position 33167499)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32310225
GRCz11 8 32319457
KASP Assay ID:
554-3300.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATCCCTGTAAACTTTTTTTTTTTCTTTTTTGAATGCAGATCGCCACA[C/T]AGATAGCAGTGCTGATCGCWAAAGTGGCACGTCTGGACTGTCCTCGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045295 Nonsense 749 975 23 29
ENSDART00000133245   None 85 None 3
ENSDART00000138268   None 543 None 17
ENSDART00000145325 Nonsense 735 961 23 29
Genomic Location (Zv9):
Chromosome 8 (position 32973844)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32116570
GRCz11 8 32125802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTGAACTCCTGAGCGACATCACCAATGAAGGCCAGGTCCAGGTTT[T/A]GAAGGTACTGTATGACTCAATCTTTCACACTCTTTCTACTCACAGCCCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link