Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:91897
- Ensembl ID:
- ENSDARG00000054224
- ZFIN ID:
- ZDB-GENE-040711-1
- Description:
- importin-11 isoform 1 [Source:RefSeq peptide;Acc:NP_001153133]
- Human Orthologue:
- IPO11
- Human Description:
- importin 11 [Source:HGNC Symbol;Acc:20628]
- Mouse Orthologue:
- Ipo11
- Mouse Description:
- importin 11 Gene [Source:MGI Symbol;Acc:MGI:2442377]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa2457 | Nonsense | F2 line generated | During 2018 |
| sa34440 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2457
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000045295 | Nonsense | 108 | 975 | 4 | 29 |
| ENSDART00000133245 | None | 85 | None | 3 | |
| ENSDART00000138268 | Nonsense | 108 | 543 | 5 | 17 |
| ENSDART00000145325 | Nonsense | 108 | 961 | 4 | 29 |
- Genomic Location (Zv9):
- Chromosome 8 (position 33167499)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 32310225 GRCz11 8 32319457 - KASP Assay ID:
- 554-3300.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAATCCCTGTAAACTTTTTTTTTTTCTTTTTTGAATGCAGATCGCCACA[C/T]AGATAGCAGTGCTGATCGCWAAAGTGGCACGTCTGGACTGTCCTCGGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34440
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000045295 | Nonsense | 749 | 975 | 23 | 29 |
| ENSDART00000133245 | None | 85 | None | 3 | |
| ENSDART00000138268 | None | 543 | None | 17 | |
| ENSDART00000145325 | Nonsense | 735 | 961 | 23 | 29 |
- Genomic Location (Zv9):
- Chromosome 8 (position 32973844)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 32116570 GRCz11 8 32125802 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTGTGAACTCCTGAGCGACATCACCAATGAAGGCCAGGTCCAGGTTT[T/A]GAAGGTACTGTATGACTCAATCTTTCACACTCTTTCTACTCACAGCCCGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Alcohol and nictotine co-dependence: Genome-wide significant association signals in IPO11-HTR1A region specific for alcohol and nicotine codependence. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
