valopb

Ensembl ID:
ENSDARG00000054181
ZFIN ID:
ZDB-GENE-040724-41
Description:
vertebrate ancient long opsin [Source:RefSeq peptide;Acc:NP_001103750]
Human Orthologues:
OPN1LW, OPN1MW, OPN1MW2, OPN1SW, RHO
Human Descriptions:
opsin 1 (cone pigments), long-wave-sensitive [Source:HGNC Symbol;Acc:9936]
opsin 1 (cone pigments), medium-wave-sensitive 2 [Source:HGNC Symbol;Acc:26952]
opsin 1 (cone pigments), medium-wave-sensitive [Source:HGNC Symbol;Acc:4206]
opsin 1 (cone pigments), short-wave-sensitive [Source:HGNC Symbol;Acc:1012]
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologues:
Opn1mw, Opn1sw, Rho
Mouse Descriptions:
opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) Gene [Source:MGI Symbol;Acc
opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan) Gene [Source:MGI Symbol;Acc:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14318 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076334 Essential Splice Site 307 392 5 5
ENSDART00000142089   None 321 None 4
Genomic Location (Zv9):
Chromosome 12 (position 30560755)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28897692
GRCz11 12 29012594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATNNNNNNGACCTCTGATCCTTATTTACTTTCAATCTAACACTCTTTCTYTTTA[G/A]TTCAGGAAGTGCTTGATCCAGATGTTTAAAGGAAACGGCACGGCCCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link