si:dkeyp-66d1.4

Ensembl ID:
ENSDARG00000054162
ZFIN ID:
ZDB-GENE-070912-659
Human Orthologue:
NFATC4
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc4
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 Gene [Source:MGI Symbol;Ac

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9818 Essential Splice Site Available for shipment Available now
sa32972 Nonsense Mutation detected in F1 DNA During 2018
sa32971 Essential Splice Site Available for shipment Available now
sa39889 Nonsense Mutation detected in F1 DNA During 2018
sa32970 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110781 Essential Splice Site 46 865 1 13
ENSDART00000146885   None 558 None 13
Genomic Location (Zv9):
Chromosome 2 (position 37517368)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37814078
GRCz11 2 37796535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGGCCCAGAGGACACYGAGAGCGGGCACAGCAACCAGGAGTCTGCCGG[T/C]ATGAGATTGAGATCCGCTCAAAGATGNNNNNNNNNNNNNNNNNNNNNNTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110781 Nonsense 185 865 3 13
ENSDART00000146885 Nonsense 116 558 5 13
Genomic Location (Zv9):
Chromosome 2 (position 37510955)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37807665
GRCz11 2 37790122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGCTGAGTCCGGCGTCAAGCTGCGATTCACTTCTGGTGGAGGAGGAT[G/T]AGCTCAATGATGCCGCTGCCCACTTCTGCCTGTCGCCCTCCTCACGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110781 Essential Splice Site 373 865 5 13
ENSDART00000146885 Essential Splice Site 304 558 7 13
Genomic Location (Zv9):
Chromosome 2 (position 37507657)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37804367
GRCz11 2 37786824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCGAGGAGCAGTAAAGGCGTCACCTGGAGGCCATCCCGTGGTGAAGG[T/G]AACTTTCATTACTTATTATTATGTCATGAATGTAAATATAACAAAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110781 Nonsense 571 865 11 13
ENSDART00000146885 Nonsense 502 558 13 13
Genomic Location (Zv9):
Chromosome 2 (position 37503459)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37800169
GRCz11 2 37782626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATAAATGTACTGAAACTGAATCTCTGAATTTTCTTCTGGTCCAGAATT[T/A]GCTGTGTGTGCGAGTGCCAGCCTACAATGACCTTTCATTGAGCCATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110781 Nonsense 772 865 12 13
ENSDART00000146885   None 558 None 13
Genomic Location (Zv9):
Chromosome 2 (position 37499436)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37796146
GRCz11 2 37778603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGTCCCATCTCCACCTCACCTCTTCCTCCTCTTAATCACTCCTCGTA[T/A]CCACACTGTCCCTGCCCGCAGGATATGTGCTCATCGCCTCCGTCACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link