zgc:153219

Ensembl ID:
ENSDARG00000054054
ZFIN ID:
ZDB-GENE-060929-144
Description:
hypothetical protein LOC767641 [Source:RefSeq peptide;Acc:NP_001070049]
Human Orthologues:
ITLN1, ITLN2
Human Descriptions:
intelectin 1 (galactofuranose binding) [Source:HGNC Symbol;Acc:18259]
intelectin 2 [Source:HGNC Symbol;Acc:20599]
Mouse Orthologues:
Gm9765, Itln1
Mouse Descriptions:
intelectin 1 (galactofuranose binding) Gene [Source:MGI Symbol;Acc:MGI:1333831]
predicted gene 9765 Gene [Source:MGI Symbol;Acc:MGI:3642721]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9989 Nonsense Available for shipment Available now
sa7071 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076181 Nonsense 48 325 3 8
ENSDART00000142450 Nonsense 48 325 3 8
Genomic Location (Zv9):
Chromosome 7 (position 34466846)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32861186
GRCz11 7 33132336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTCAGCATCAACCCTGAGATTGCAAAATTTGTGRACAGAATTAAATA[T/G]GTTGSTCRAAGYTGCAAAGARATCYGTGACAAGTACCATGTTTATGARGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076181 Splice Site, Nonsense 242 325 7 8
ENSDART00000142450 Splice Site, Nonsense 242 325 7 8
Genomic Location (Zv9):
Chromosome 7 (position 34467938)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32862278
GRCz11 7 33133428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAYTTTATKACATCATTAATAATATATTCTCTGTGNTTTTTTCAGCA[C/T]AATTTGAGCCTGGATTCATCACATTCAGAGTCTTAAATWATGAAAAGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link