zgc:110326

Ensembl ID:
ENSDARG00000054050
ZFIN ID:
ZDB-GENE-050417-338
Description:
hypothetical protein LOC550503 [Source:RefSeq peptide;Acc:NP_001017805]
Human Orthologues:
C1orf204, VSIG8
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
V-set and immunoglobulin domain containing 8 [Source:HGNC Symbol;Acc:32063]
Mouse Orthologue:
Vsig8
Mouse Description:
V-set and immunoglobulin domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:3642995]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21709 Essential Splice Site Available for shipment Available now
sa31776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097930 Essential Splice Site 41 359 3 9
Genomic Location (Zv9):
Chromosome 10 (position 19558640)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19570986
GRCz11 10 19528420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGTCCTCATTTATGATATTGACTGTGTTCATCCTGTTTCTCAAAGCAA[G/T]TAAGTTTCTTAGTAAAAAATAAACCTTGATGTACTTTGAAACTTTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097930 Nonsense 86 359 4 9
Genomic Location (Zv9):
Chromosome 10 (position 19564974)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19577320
GRCz11 10 19534754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTACTCGTCTGGTCCAGCAGACACAGGAGAGCTTGACATTGAGTGGT[C/A]AGTCATCAGCCCAGACACCACCAAAAAAGACCAGATGGTGCGTAAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link