
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cu137686.1
- Ensembl ID:
- ENSDARG00000054028
- ZFIN IDs:
- ZDB-GENE-030131-7027, ZDB-GENE-081031-13, ZDB-GENE-081031-14
- Description:
- Wu:fk66a11 protein [Source:UniProtKB/TrEMBL;Acc:Q6AZB4]
- Human Orthologue:
- ATP11B
- Human Description:
- ATPase, class VI, type 11B [Source:HGNC Symbol;Acc:13553]
- Mouse Orthologue:
- Atp11b
- Mouse Description:
- ATPase, class VI, type 11B Gene [Source:MGI Symbol;Acc:MGI:1923545]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16252 | Essential Splice Site | Available for shipment | Available now |
sa11368 | Nonsense | Available for shipment | Available now |
sa9669 | Essential Splice Site | Available for shipment | Available now |
sa39387 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16252
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076151 | Essential Splice Site | 235 | 1149 | 8 | 30 |
ENSDART00000134544 | Essential Splice Site | 157 | 1000 | 5 | 25 |
- Genomic Location (Zv9):
- Chromosome 22 (position 39988048)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 37066353 GRCz11 22 37007098 - KASP Assay ID:
- 2261-7098.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTTTRTCGGGAGAATAACAGTAACCCAGCATGGAGAGGAGATMGTCAGG[T/C]AAGGCTTYAGTTYACTCGATYAGAGGAAWTAAAATCATTTGTAGATGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11368
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076151 | Nonsense | 300 | 1149 | 11 | 30 |
ENSDART00000134544 | Nonsense | 222 | 1000 | 8 | 25 |
- Genomic Location (Zv9):
- Chromosome 22 (position 39986257)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 37063877 GRCz11 22 37004622 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGATCAATGAATAYATTTCTCATCATCTACTTGGGCATCCTGCWGTTT[G/T]AAGCCATCCTCAGCACCAYTTTAAAGTACGCCTGGCAGGCGGAGGACAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9669
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076151 | Essential Splice Site | 723 | 1149 | 19 | 30 |
ENSDART00000134544 | Essential Splice Site | 645 | 1000 | 16 | 25 |
- Genomic Location (Zv9):
- Chromosome 22 (position 39969077)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 37047443 GRCz11 22 36988188 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGAAATCAGACAACGAGTGCGCAGAGCAGCTCCGCAGGCTGGCCCGGAG[G/A]TACACAGATTCACACASCATTCAAGTGTATTTWTTTYACTCAGCAGTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39387
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076151 | Essential Splice Site | 877 | 1149 | 23 | 30 |
ENSDART00000134544 | Essential Splice Site | 799 | 1000 | 20 | 25 |
- Genomic Location (Zv9):
- Chromosome 22 (position 39962522)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 37040829 GRCz11 22 36981574 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCACTCCCCAGTTTTTATACCAGTTCTTCTGTCTGTTCTCTCAGCAAG[T/C]AAGTGTCTCCTGATGCTACCGTTTTTGTTGATACAGGATATTTTTTAAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: