ttll6

Ensembl ID:
ENSDARG00000054023
ZFIN ID:
ZDB-GENE-080107-1
Description:
Tubulin polyglutamylase ttll6 [Source:UniProtKB/Swiss-Prot;Acc:A8CVX7]
Human Orthologue:
TTLL6
Human Description:
tubulin tyrosine ligase-like family, member 6 [Source:HGNC Symbol;Acc:26664]
Mouse Orthologue:
Ttll6
Mouse Description:
tubulin tyrosine ligase-like family, member 6 Gene [Source:MGI Symbol;Acc:MGI:2683461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44764 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066278 Nonsense 179 778 5 14
Genomic Location (Zv9):
Chromosome 12 (position 28674178)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27011787
GRCz11 12 27103147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACATTTATCTGCAAGCCAGACTCAGGTTGCCAAGGTCGTGGTATTTA[T/A]CTTACCAAGTCTAACAAGGATATTCGGCCAGGAGAACACATGATTTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link