zgc:77285

Ensembl ID:
ENSDARG00000054007
ZFIN ID:
ZDB-GENE-040426-1814
Description:
hypothetical protein LOC402967 [Source:RefSeq peptide;Acc:NP_991231]
Human Orthologue:
PPP1R2
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 2 [Source:HGNC Symbol;Acc:9288]
Mouse Orthologues:
2810408A11Rik, 4930403L05Rik, Ppp1r2
Mouse Descriptions:
protein phosphatase 1, regulatory (inhibitor) subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1914099]
RIKEN cDNA 2810408A11 gene Gene [Source:MGI Symbol;Acc:MGI:1917669]
RIKEN cDNA 4930403L05 gene Gene [Source:MGI Symbol;Acc:MGI:1914645]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45781 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076128 Nonsense 189 204 5 6
Genomic Location (Zv9):
Chromosome 22 (position 40795603)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37875518
GRCz11 22 37810526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGGATGAGGATGAAGATGAAGAGATGAAGGATGACACAGAGACT[G/T]AGGACATCACCGTCGACCCCCCGCAAGATGGTACATCCAAATGATGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link