zgc:171777

Ensembl ID:
ENSDARG00000053995
ZFIN ID:
ZDB-GENE-070928-32
Description:
protein BAT4 [Source:RefSeq peptide;Acc:NP_001099173]
Human Orthologue:
BAT4
Human Description:
HLA-B associated transcript 4 [Source:HGNC Symbol;Acc:13920]
Mouse Orthologue:
Bat4
Mouse Description:
HLA-B associated transcript 4 Gene [Source:MGI Symbol;Acc:MGI:2148975]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6586 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076120 Essential Splice Site None 208 1 4
ENSDART00000129259   None 343 None 4
Genomic Location (Zv9):
Chromosome 1 (position 24928077)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25351775
GRCz11 1 26045489
KASP Assay ID:
554-4604.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTACTGGACGTAAGTGTGTGTTCATTACCTTGGGTTTACTGGACG[T/G]AAGTGTGTGTTCATTACCTTGGGTTTAATTTGGACGTGTTTATCTTTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link