
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bc2
- Ensembl ID:
- ENSDARG00000053979
- ZFIN ID:
- ZDB-GENE-040426-2922
- Description:
- Charged multivesicular body protein 2a [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW25]
- Human Orthologue:
- CHMP2A
- Human Description:
- chromatin modifying protein 2A [Source:HGNC Symbol;Acc:30216]
- Mouse Orthologue:
- Chmp2a
- Mouse Description:
- chromatin modifying protein 2A Gene [Source:MGI Symbol;Acc:MGI:1916203]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22108 | Nonsense | Available for shipment | Available now |
sa8643 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa4469 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa22108
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076103 | Nonsense | 38 | 220 | 2 | 6 |
The following transcripts of ENSDARG00000053979 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 28600864)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 26938473 GRCz11 12 27029833 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTAAATAGAGCCATGCGGGATCTAGACAGAGAACGGCAGAGACTGGAG[C/T]AGCAGGAAAAGAAAATAATCGCAGACATAAAAAAAATGGCCAAACAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8643
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076103 | Nonsense | 105 | 220 | 3 | 6 |
The following transcripts of ENSDARG00000053979 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 28600591)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 26938200 GRCz11 12 27029560 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAAAATTCAAACCCTCAAATCAAACAACAGCATGGCGCAGGCCATGAAA[G/T]GAGTCACCAAAGCTATGGCCACCATGAACAGACAGGYACTGTACAKCCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4469
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076103 | Essential Splice Site | 116 | 220 | None | 6 |
The following transcripts of ENSDARG00000053979 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 28600554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 26938163 GRCz11 12 27029523 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGGCCATGAAAGGAGTCACCAAAGCTATGGCCACCATGAACAGACAGG[T/C]ACTGTACAKCCGCTAAAAAGTCCTGCCAACAGAKAGTTTGTTCTTACGCN
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: