cdc42ep2

Ensembl ID:
ENSDARG00000053959
ZFIN ID:
ZDB-GENE-050320-104
Description:
cdc42 effector protein 2 [Source:RefSeq peptide;Acc:NP_001013549]
Human Orthologue:
CDC42EP2
Human Description:
CDC42 effector protein (Rho GTPase binding) 2 [Source:HGNC Symbol;Acc:16263]
Mouse Orthologue:
Cdc42ep2
Mouse Description:
CDC42 effector protein (Rho GTPase binding) 2 Gene [Source:MGI Symbol;Acc:MGI:1929744]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45214 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076083 Nonsense 242 247 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39330103)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37129787
GRCz11 5 37729940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACAAGCAGAGAACGGGAACGTTCAATGGGGGACTTGCACCCAGCGGA[C/T]GACAAGGAATATATACCTGATATTGAACACGAAGAAATGAGTCAAAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link