srf

Ensembl ID:
ENSDARG00000053918
ZFIN ID:
ZDB-GENE-990714-29
Description:
serum response factor [Source:RefSeq peptide;Acc:NP_001103996]
Human Orthologue:
SRF
Human Description:
serum response factor (c-fos serum response element-binding transcription factor) [Source:HGNC Symbo
Mouse Orthologue:
Srf
Mouse Description:
serum response factor Gene [Source:MGI Symbol;Acc:MGI:106658]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24211 Nonsense Available for shipment Available now
sa5694 Nonsense F2 line generated During 2018
sa3160 Nonsense F2 line generated During 2018
sa11724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076035 Nonsense 107 520 2 9
ENSDART00000076040 Nonsense 126 539 1 8

The following transcripts of ENSDARG00000053918 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 37975257)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35113975
GRCz11 22 35089724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGGCCGGAGCGAAGCCCGGCAAGAAAACGCGAGGACGGGTGAAAATT[A/T]AGATGGAGTTTATTGACAACAAGCTGAGGAGATACACGACCTTCAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5694
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076035 Nonsense 212 520 3 9
ENSDART00000076040 Nonsense 231 539 2 8
ENSDART00000076035 Nonsense 212 520 3 9
ENSDART00000076040 Nonsense 231 539 2 8

The following transcripts of ENSDARG00000053918 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 37987269)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35125987
GRCz11 22 35101736
KASP Assay ID:
554-2634.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAGTGCCACGGGATTCGAGGAGACYGACCTCACCTACCAGGTCTCA[G/T]AGGCTGATGGCCTCACAGAGCCAAAGGTACCTGCCTTCTACTTRAATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3160
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076035 Nonsense 212 520 3 9
ENSDART00000076040 Nonsense 231 539 2 8
ENSDART00000076035 Nonsense 212 520 3 9
ENSDART00000076040 Nonsense 231 539 2 8

The following transcripts of ENSDARG00000053918 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 37987269)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35125987
GRCz11 22 35101736
KASP Assay ID:
554-2634.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAGTGCCACGGGATTCGAGGAGACYGACCTCACCTACCAGGTCTCA[G/T]AGGCTGATGGCCTCACAGAGCCAAAGGTACCTGCCTTCTACTTRAATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076035 Nonsense 334 520 5 9
ENSDART00000076040 Nonsense 353 539 4 8

The following transcripts of ENSDARG00000053918 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 38002208)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35140926
GRCz11 22 35116675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACACACACTGTTCCTCKCAGTCAGCTGCAGACACACTCTCTGGCCATA[C/T]AGTGTCCACAGACGCAGGCCAACAGCAGCGGCAGSACYGCTGTCCCCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link