zgc:162909

Ensembl ID:
ENSDARG00000053896
ZFIN ID:
ZDB-GENE-070424-43
Description:
hypothetical protein LOC100038803 [Source:RefSeq peptide;Acc:NP_001083052]
Human Orthologue:
SLC30A1
Human Description:
solute carrier family 30 (zinc transporter), member 1 [Source:HGNC Symbol;Acc:11012]
Mouse Orthologue:
Slc30a1
Mouse Description:
solute carrier family 30 (zinc transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1345281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6490 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45615 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104009 Essential Splice Site 190 475 1 2
Genomic Location (Zv9):
Chromosome 17 (position 37384151)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37269048
GRCz11 17 37216633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCATGATAAACAGTTCACAAGGAGATCACACTTGCGAGCAGAAATCAG[G/A]TATTTATGTTGGTCAAAAATAAAATACTTTTTWAACTCCNNNNNNNNNTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104009 Nonsense 387 475 2 2
Genomic Location (Zv9):
Chromosome 17 (position 37388139)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37273036
GRCz11 17 37220621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCAAATGCACCGATCCGGCTTTGTACATGGACATCGCCAAACGCATT[A/T]AAGACGTCTTCCACGATGAAGGCATACACGCTACTACCGTTCAACCAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link