zgc:77419

Ensembl ID:
ENSDARG00000053890
ZFIN ID:
ZDB-GENE-040426-1837
Human Orthologue:
TMEM62
Human Description:
transmembrane protein 62 [Source:HGNC Symbol;Acc:26269]
Mouse Orthologue:
Tmem62
Mouse Description:
transmembrane protein 62 Gene [Source:MGI Symbol;Acc:MGI:2139461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39171 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076004 Nonsense 374 639 9 14

The following transcripts of ENSDARG00000053890 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 37435584)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37320481
GRCz11 17 37268066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACGGAGTTACACTGGGAAAAGCAGTCAGCGCTGGAGGTCCTCTATA[T/A]GTGCTGCTCTGGGATCCAATGCACTACGCTACAGGACTGCACACTATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link