si:dkeyp-53h3.2

Ensembl ID:
ENSDARG00000053884
ZFIN ID:
ZDB-GENE-060810-107
Human Orthologue:
MED13
Human Description:
mediator complex subunit 13 [Source:HGNC Symbol;Acc:22474]
Mouse Orthologue:
Med13
Mouse Description:
mediator complex subunit 13 Gene [Source:MGI Symbol;Acc:MGI:3029632]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45410 Nonsense Mutation detected in F1 DNA During 2018
sa21755 Essential Splice Site Available for shipment Available now
sa41677 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1643 Essential Splice Site F2 line generated During 2018
sa16900 Nonsense Available for shipment Available now
sa13843 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088852 Nonsense 692 2157 10 30
ENSDART00000134491 Nonsense 692 2175 10 30
Genomic Location (Zv9):
Chromosome 10 (position 28732478)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28164072
GRCz11 10 28050697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAGACTGCTTAAGGTCTCAGATGAGCGGATCCAGATGTACCTGCAG[C/T]GACAGAACCAGCACCTGGCTGCAGCCATCACAGACGGCGACCACGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088852 Essential Splice Site 823 2157 14 30
ENSDART00000134491 Essential Splice Site 841 2175 14 30
Genomic Location (Zv9):
Chromosome 10 (position 28727542)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28159136
GRCz11 10 28045761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCCTTTCACTAACATGTCATCTTTTTCTTTGCTTGTCCCTCCCTC[A/G]GGCACAGCCGATCTTCACCAGATGTTCCCTACGCCTCCGTCTTTAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088852 Essential Splice Site 892 2157 14 30
ENSDART00000134491 Essential Splice Site 910 2175 14 30
Genomic Location (Zv9):
Chromosome 10 (position 28727330)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28158924
GRCz11 10 28045549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGAGGTAGAGGAGAGCTTCTGCAGCCCCAAACCTTCTGAAATCAAGG[T/A]GAGATGCTACATTATACATGTCCTAAATTTGTGAAATTCAACAAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1643
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088852 Essential Splice Site 1320 2157 17 30
ENSDART00000134491 Essential Splice Site 1338 2175 17 30
Genomic Location (Zv9):
Chromosome 10 (position 28724297)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28155891
GRCz11 10 28042516
KASP Assay ID:
554-1583.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTYACATGGCAGCAGTTTCACAAAATGGCTGGAAGAGGTTCTTACGG[T/G]GAGTAACAAGCCACTCAAAACACTAAAAATGCCATCACAATTTTTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088852 Nonsense 1858 2157 24 30
ENSDART00000134491 Nonsense 1876 2175 24 30
Genomic Location (Zv9):
Chromosome 10 (position 28719440)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28151034
GRCz11 10 28037659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGAGAGTTGTGATTGGCCGGCTWGGACGGATAGGGCATGGAGAGTTG[C/T]GAGGTAATGGCTGTTTAAACGCTTTTACATTATACACAATACAGCTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088852 Nonsense 2117 2157 30 30
ENSDART00000134491 Nonsense 2135 2175 30 30
Genomic Location (Zv9):
Chromosome 10 (position 28712986)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28144580
GRCz11 10 28031205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTAATAAGCATTAATATTTAACTGTTTCTSTTTTGTAGATTTGTGT[T/A]GGAGCAGTAYAATGCCCTTTCCTGGCTGACCTGTGACCCTGCGACCCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link