zgc:123248

Ensembl ID:
ENSDARG00000053878
ZFIN ID:
ZDB-GENE-051127-29
Description:
type I inositol-1,4,5-trisphosphate 5-phosphatase [Source:RefSeq peptide;Acc:NP_001032658]
Human Orthologue:
INPP5A
Human Description:
inositol polyphosphate-5-phosphatase, 40kDa [Source:HGNC Symbol;Acc:6076]
Mouse Orthologue:
Inpp5a
Mouse Description:
inositol polyphosphate-5-phosphatase A Gene [Source:MGI Symbol;Acc:MGI:2686961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15032 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075989 Essential Splice Site 321 396 13 16
ENSDART00000124659 Essential Splice Site 321 396 13 16
Genomic Location (Zv9):
Chromosome 8 (position 39516517)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38395320
GRCz11 8 38428259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACTGGTTTGTCTGTCAGAAAKTTAWGTGAGGATCATTTTTACTNTTTCA[G/A]TTACCCATACAGTGAAGATTACACTAAACCTACACAGTACATGAACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link