zgc:152928

Ensembl ID:
ENSDARG00000053877
ZFIN ID:
ZDB-GENE-060929-1270
Description:
hypothetical protein LOC555848 [Source:RefSeq peptide;Acc:NP_001071008]
Human Orthologue:
CPD
Human Description:
carboxypeptidase D [Source:HGNC Symbol;Acc:2301]
Mouse Orthologue:
Cpd
Mouse Description:
carboxypeptidase D Gene [Source:MGI Symbol;Acc:MGI:107265]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15154 Essential Splice Site Available for shipment Available now
sa15322 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076000 Essential Splice Site 712 1275 10 21
ENSDART00000113607   None 389 None 12
ENSDART00000076000 Essential Splice Site 712 1275 10 21
ENSDART00000113607   None 389 None 12
Genomic Location (Zv9):
Chromosome 21 (position 38045083)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39165162
GRCz11 21 39210220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATACTGGGAGAAGAATCATAAAGCRCTCTTACAGTTCATGCAGCAGG[T/C]GATTCATTCCTGGCCATRACATTGTCTATTTTTGGTTGAGCAATTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076000 Essential Splice Site 712 1275 10 21
ENSDART00000113607   None 389 None 12
ENSDART00000076000 Essential Splice Site 712 1275 10 21
ENSDART00000113607   None 389 None 12
Genomic Location (Zv9):
Chromosome 21 (position 38045083)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39165162
GRCz11 21 39210220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATACTGGGAGAAGAATCATAAAGCRCTCTTACAGTTCATGCAGCAGG[T/C]GATTCATTCCTGGCCATRACATTGTCTATTTTTGGTTGAGCAATTCAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link