zgc:162431

Ensembl ID:
ENSDARG00000053857
ZFIN ID:
ZDB-GENE-070410-81
Description:
hypothetical protein LOC100037381 [Source:RefSeq peptide;Acc:NP_001083002]
Human Orthologue:
CCDC50
Human Description:
coiled-coil domain containing 50 [Source:HGNC Symbol;Acc:18111]
Mouse Orthologue:
Ccdc50
Mouse Description:
coiled-coil domain containing 50 Gene [Source:MGI Symbol;Acc:MGI:1914751]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24365 Essential Splice Site Available for shipment Available now
sa24364 Nonsense Available for shipment Available now
sa10456 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075973   None 360 None 11
ENSDART00000103480 Essential Splice Site None 347 None 12
ENSDART00000122239 Essential Splice Site None 345 None 13
ENSDART00000127192   None 243 None 9
ENSDART00000130287   None 720 None 12
ENSDART00000131209   None 135 None 6

The following transcripts of ENSDARG00000053857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30284052)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30118942
GRCz11 23 30045473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGATACAAAGCGCATTTGTAGAGAAGAAAAGAGCTCAGAGACCAGG[T/A]AAGAGGCTGTTTGTGTCGCTGTGAATTATGTTTTCGGTGTCTGACGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075973 Nonsense 6 360 1 11
ENSDART00000103480   None 347 None 12
ENSDART00000122239 Nonsense 6 345 3 13
ENSDART00000127192 Nonsense 6 243 2 9
ENSDART00000130287   None 720 None 12
ENSDART00000131209 Nonsense 6 135 2 6

The following transcripts of ENSDARG00000053857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30277050)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30111940
GRCz11 23 30038471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTCTTGTCATCCCCTATCCCCAGGCATAGAGTATGTTGGCTGCTGAA[C/T]AAAACAAACCAGCTACTGGGTCTGCAGAGCCTCCGGACGTCTCAAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075973   None 360 None 11
ENSDART00000103480   None 347 None 12
ENSDART00000122239   None 345 None 13
ENSDART00000127192   None 243 None 9
ENSDART00000130287 Nonsense 161 720 6 12
ENSDART00000131209   None 135 None 6

The following transcripts of ENSDARG00000053857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30259439)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30094329
GRCz11 23 30020860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCATACTCACCTCAGCCTGTTCAAACATCTCACAACCRGTCTCYGACA[C/T]GAAGATGTCAGCACTCCATTTCTCCCAACTATTCTGACTTTGAGGAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link