uts2a

Ensembl ID:
ENSDARG00000053854
ZFIN ID:
ZDB-GENE-040630-11
Description:
urotensin 2, alpha [Source:RefSeq peptide;Acc:NP_998013]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37746 Nonsense Mutation detected in F1 DNA During 2018
sa44015 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075966 Nonsense 107 125 4 5
ENSDART00000126027 Nonsense 107 125 4 4
Genomic Location (Zv9):
Chromosome 23 (position 30293923)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30128813
GRCz11 23 30055344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAAAAGCCATATCGCCTGGTTCCTCCCAGTGGTCTTTTGGGGAGC[A/T]GAAGGCAGTTCAGAAAGAGAGGTGGCGGTGCAGACTGTTTCTGGAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075966 Essential Splice Site None 125 None 5
ENSDART00000126027   None 125 4 4
Genomic Location (Zv9):
Chromosome 23 (position 30294036)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30128926
GRCz11 23 30055457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACCACACACTCCACGCAGTCACAGGGCTTTTATAGACTTTCCAACC[A/G]CTCTGGACTCACAATTATACAACAACACAAATGCAAAATGTACAAGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link