slc13a2

Ensembl ID:
ENSDARG00000053853
ZFIN ID:
ZDB-GENE-040426-2389
Description:
solute carrier family 13 member 2 [Source:RefSeq peptide;Acc:NP_998617]
Human Orthologue:
SLC13A2
Human Description:
solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 [Source:HGNC Symbol;
Mouse Orthologue:
Slc13a2
Mouse Description:
solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13412 Nonsense Available for shipment Available now
sa43700 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075958 Nonsense 14 613 1 12
Genomic Location (Zv9):
Chromosome 21 (position 37935301)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39055380
GRCz11 21 39100438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACACAGRCATGGGGTGCACCAAAGCAAGTTTAGTTCTGCGCTGGCTGT[T/A]GCTTCACAGAAACTACATCCTTATCTTSTGTGTTCCTCTGCTCATTTTMC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075958 Nonsense 81 613 2 12
Genomic Location (Zv9):
Chromosome 21 (position 37938467)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39058546
GRCz11 21 39103604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCCTGCTGCCCGTCGTCCTCTTCCCTATGATGGGTATCATGGAGTCT[G/T]GAAAGGTACAGTTCATTTCTGCGTCTACACTGTAAAACTTGCAGACACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link