zgc:110605

Ensembl ID:
ENSDARG00000053840
ZFIN ID:
ZDB-GENE-050417-457
Description:
etoposide induced 2.4 [Source:RefSeq peptide;Acc:NP_001017898]
Human Orthologue:
EI24
Human Description:
etoposide induced 2.4 mRNA [Source:HGNC Symbol;Acc:13276]
Mouse Orthologue:
Ei24
Mouse Description:
etoposide induced 2.4 mRNA Gene [Source:MGI Symbol;Acc:MGI:108090]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34968 Nonsense Mutation detected in F1 DNA During 2018
sa9477 Nonsense Available for shipment Available now
sa18995 Nonsense Mutation detected in F1 DNA During 2018
sa21796 Nonsense Available for shipment Available now
sa31796 Essential Splice Site Available for shipment Available now
sa21795 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075943 Nonsense 26 326 1 9
Genomic Location (Zv9):
Chromosome 10 (position 40618186)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39278135
GRCz11 10 39199622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAACCATCTCCAAACTCGATGCTCGGATTCAGCAGAAGCGAGAGGAG[C/T]AGAGGAGGCGCAGGTCGTCTGGAGCTCTGGCGATGAGACGAGCTCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075943 Nonsense 45 326 1 9
ENSDART00000075943 Nonsense 45 326 1 9
Genomic Location (Zv9):
Chromosome 10 (position 40618129)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39278192
GRCz11 10 39199679
KASP Assay ID:
2260-3596.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCAGRTCRTCTGGAGCTCTGGCGATGAGACGAGCTCAAAGCGAAGAA[C/T]GAAAACAAGACAGGTGGAACAATAACTGTATTAGCATTCACACTAGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075943 Nonsense 45 326 1 9
ENSDART00000075943 Nonsense 45 326 1 9
Genomic Location (Zv9):
Chromosome 10 (position 40618129)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39278192
GRCz11 10 39199679
KASP Assay ID:
2260-3596.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGCAGGTCGTCTGGAGCTCTGGCGATGAGACGAGCTCAAAGCGAAGAA[C/T]GAAAACAAGACAGGTGGAACAATAACTGTATTAGCATTCACACTAGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075943 Nonsense 76 326 3 9
Genomic Location (Zv9):
Chromosome 10 (position 40617071)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39278908
GRCz11 10 39200395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAAATCCTATTTGTTTGATCTCACAGCTAAGCCTGTTCCTGTTTTA[T/G]CGAGTGTTTATCCCGCTGCTGCAGTCTCTCACTGCTAGAATTATAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075943 Essential Splice Site 92 326 3 9
Genomic Location (Zv9):
Chromosome 10 (position 40617023)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39278956
GRCz11 10 39200443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCGAGTGTTTATCCCGCTGCTGCAGTCTCTCACTGCTAGAATTATAGG[T/A]AAGTGTCACATTAAAGACAGTCCATATGCTCTAGATACAGTTGAAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075943 Essential Splice Site 211 326 6 9
Genomic Location (Zv9):
Chromosome 10 (position 40612195)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39283784
GRCz11 10 39205271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCTCTACTCGCTTTACTGCTTCGAATATCGCTGGTTTAATCACGG[T/C]AAGTGTGTGGTCAGTCAGGGAGGCATAAAATAAGATTGTTTAAAGCTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link